circad | circRNAs associated with diseases

circSMARCA5
Gene	n/a	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Prostate Cancer	ICD-10	Malignant neoplasm of prostate (C61)
DBLink	Link to database	PMID	28765045
Experimental Method
Sample Type	Tissues	Comparison	tumour vs normal LNCaP cell lines
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CTCCAAGATGGGCGAAAG Reverse TGTGTTGCTCCATGTCTAATCA	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Kong, Z, Wan, X, Zhang, Y, Zhang, P, Zhang, Y, Zhang, X, Qi, X, Wu, H, Huang, J, Li, Y (2017). Androgen-responsive circular RNA circSMARCA5 is up-regulated and promotes cell proliferation in prostate cancer. Biochem. Biophys. Res. Commun., 493, 3:1217-1223.